All authors read and approved the final manuscript. Notes Ethics approval and consent LAMP3 to participate We confirmed that all animal experiments were carried out accordance with the guideline of the Guideline for the Care and Use of Laboratory Animal of the Institutional Animal Care and Use Committee (IACUC) set by Anhui Agricultural University or college. were observed in all immunized ducklings. Moreover, all ducklings were protected against challenge with the virulent DTMUV AH-F10 strain. Conclusions In conclusion, we demonstrate that this suicidal DNA vaccine is usually a promising candidate facilitating the prevention of DTMUV infection. infections [32]. Moreover, previous studies of flaviviruses such as West Nile computer virus [33], Japanese encephalitis computer virus [34], and tick-borne encephalitis computer virus [35] indicated that this gene encoding this E protein might be useful for vaccine development. For example, Wang et al. reported that mice immunized with the recombinant E protein which was expressed and purified form developed E protein antibodies and were protected from contamination MLN9708 with West Nile computer virus [36]. A previous study showed that MLN9708 immunization with pseudotype baculovirus expressing E protein of Japanese encephalitis computer virus in mice could elicit high levels of protective immunity [37]. Similarly, Raviprakash et al. found the candidate DNA vaccine expressing E protein of dengue computer virus type 1 produced dengue-1 specific antibodies that were both neutralizing and long lasting in mice [38]. All these previous studies suggest that the E glycoprotein could also be a good vaccine candidate against the DTMUV contamination. In this study, we constructed a suicidal DNA vaccine expressing the E glycoprotein of DTMUV. The efficacy of this potential vaccine was further evaluated according to humoral and cell-mediated immune responses as well as protection against the DTMUV challenge in ducklings. Methods Cell culture and computer virus propagation Duck embryo fibroblasts (DEF) were prepared from 12-day-old SPF duck embryos (Harbin Veterinary Research Institute, Harbin, China) MLN9708 according to standard protocols. Cells were seeded at a density of 106 cells/ml in Dulbeccos Modified Eagle Medium (DMEM; GIBCO), supplemented with 10% fetal bovine serum (FBS; GIBCO), 100?models/ml penicillin (GIBCO), and 100?mg/ml streptomycin (GIBCO), in an incubator at 37?C and 5% CO2. DTMUV computer virus AH-F10 is usually a virulent strain isolated during an outbreak in Anhui province, China in 2013. Suicidal DNA vaccine construction Total DTMUV RNA was extracted from a viral suspension using a TIANamp Viral Total Nucleic Acid Purification Kit (TIANGEN Biotech, Beijing, China), according to the manufacturers instructions. First-strand complementary DNA (cDNA) was then synthesized using M-MLV reverse transcriptase (Promega, Madison, WI, USA) and 6-nt random primers (Promega), and the ORF of the E gene was amplified by reverse transcription (RT)-PCR using the following primers: 5- CGGGATCCGCC ACCATGTTCAGCTGTCTGGGGATG C-3 and 5-TCCCCCGGGGGCATTGACATTTACTGCCAG-3. These primers were designed with DH5 cells, and purified using the Wizard Plus Maxiprep DNA Purification System (Promega). Detection of E expression in DEF cells DEF cells were transfected with pSCA1-E using Lipofectamine 2000 reagent (Invitrogen), according to the manufacturers instructions. Forty-eight hours post-transfection, the cells were subjected to immunofluorescence microscopy (IFA) and western blot analyses for evaluation of the expression of E protein. For IFA analysis, cell monolayers were cultured on cover slips and fixed by incubation with chilly 100% acetone for 30?min at ??20?C. Slides were then incubated with rabbit anti-E polyclonal serum (1:1,000) at 37?C for 30?min, followed by fluorescein-conjugated goat anti-rabbit antibodies (Beijing Zsbio, Beijing, China) at 37?C for 30?min. Cells were visualized using a Leica fluorescence microscope (Olympus, Tokyo, Japan). For western blot analyses, DEF cells were transfected with pSCA1-E, cultivated for 48?h, and lysed by incubation with lysis buffer. Proteins were MLN9708 then separated by 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). Membranes were incubated MLN9708 with rabbit anti-DTMUV E protein polyclonal serum (1:1,000), followed by HRP-conjugated goat anti-rabbit IgG antibodies (Beijing Zsbio). Protein bands were visualized by 3, 3-diaminobenzidine tetrahydrochloride staining (TIANGEN). Immunization of ducks and computer virus challenge Forty female specific-pathogen-free (SPF) Sheldrake ducklings (7-day-old, free of anti-DTMUV antibodies) were obtained from Harbin Veterinary Research Institute, China. The ducklings were randomly divided into four groups of 10 ducklings each, and housed in individual rooms. The animals were then immunized by intramuscular.